Mem Inst Oswaldo Cruz, Rio de Janeiro, 108(4) June 2013
Short communication

DsRed2 transient expression in Culex quinquefasciatus mosquitoes

André Barretto Bruno Wilke1,+, Sarah Scaife2, Luke Alphey2,3, Mauro Toledo Marrelli1

1Departamento de Epidemiologia, Faculdade de Saúde Pública, Universidade de São Paulo, São Paulo, SP, Brasil
2Oxitec Ltd, Oxford, Oxford, United Kingdom
3Department of Zoology, University of Oxford, Oxford, Oxford, United Kingdom

Page: 529-531 DOI: 10.1590/0074-0276108042013023
5633 views 1291 downloads
ABSTRACT

Culex quinquefasciatusu00a0mosquitoes have been successfully genetically modified only once, despite the efforts of several laboratories to transform and establish a stable strain. We have developed a transient gene expression method, inu00a0Culex, that delivers plasmid DNA directly to the mosquito haemolymph and additional tissues. We were able to expressu00a0DsRed2u00a0fluorescent protein in adultu00a0Cx. quinquefasciatusu00a0mosquitoes by injecting plasmids directly into their thorax. The expression ofu00a0DsRed2u00a0in adultu00a0Cx. quinquefasciatusu00a0mosquitoes is an important stepping stone to genetic transformation and the potential use of new control strategies and genetic interactions.

Mosquitoes are responsible for the transmission of major human disease agents (Moreira et al. 2000, Cheng et al. 2011). Anopheles, Culex and Aedes genera include vectors for the three major groups of human pathogens: parasites of the Plasmodium genus, which cause malaria, filarids of the Wuchereria and Brugia genera, which cause filariasis, and a variety of arboviruses, including dengue, yellow fever and West Nile (Atkinson & Michel 2002, Wilke et al. 2009b).

Given the failure of current methods to control the spread of many of these diseases, alternative methods of control are desperately needed, so considerable effort has gone into novel genetic mosquito control strategies (Atkinson et al. 2007). Substantial progress has been made over the last decade towards generating transgenic mosquitoes (Wilke et al. 2009a).

Two broad classes of genetic control strategies have been proposed. "Population suppression" strategies aim to reduce the number of vector mosquitoes in the target area. "Population replacement" strategies aim to make the vector population less effective at transmitting relevant pathogens, without necessarily reducing the number of mosquitoes. Population suppression strategies require the expression of effector molecules that reduce the fitness (e.g. viability, fertility) of affected mosquitoes. Population replacement requires the expression of effector molecules that affect the ability of the mosquito to transmit the pathogen ("refractoriness genes"); additionally "gene drive" systems may be required to spread such genes through the target population. In each case, there is a need to identify specific DNA sequences which will impart the necessary phenotype when present in the mosquito genome. The traditional way to test candidate effector sequences is by constructing stable transgenic lines in which the candidate sequence is inserted into the mosquito genome. However, germline transformation is a time-consuming process and routine in only a few mosquito species. In particular, there has been only two reports of transformation of Culex mosquito by a same group (Allen et al. 2001, Allen & Christensen 2004), despite the efforts of several laboratories.

While germline transformation is likely to remain essential for many purposes, it would be highly desirable to have a faster method for initial screening of candidate effector molecules and plasmid functionalities. Based on the success of adult RNAi microinjection in Aedes and Anopheles mosquito species (Blandin et al. 2002, Hansen et al. 2004) and the observation that plasmid DNA is transcribed in various mammalian tissues following injection of purified DNA (Zhang et al. 2003, Danialou et al. 2005), we have developed a mosquito transient gene expression method, based on the delivery of plasmid DNA directly to the mosquito haemolymph and additional tissues.

The development of a well-established adult microinjection system in Culex mosquitoes is crucial to the implementation of new technologies such as paratransgenesis and interactions between bacteria and mosquito (Kambris et al. 2010), as well as the study of gene promoters and refractory genes (Ren et al. 2008, Coutinho-Abreu et al. 2010, Fang et al. 2011, Rasgon 2011). We were able to express DsRed2 fluorescent molecular marker in adult Culex quinquefasciatus mosquitoes by micro-injecting plasmids directly into the thorax.

To be able to test if the target mosquito is capable of expressing the gene of interest, in such a way, is highly advantageous since it is a very arduous process to transform and maintain transgenic mosquito strains. Cx. quinquefasciatus mosquitoes were injected in the thorax with a DsRed2 marker comprising DsRed2 coding sequence under the control of a baculovirus promoter (Hr5IE1) which has previously been shown to give visible ubiquitous red fluorescence in transgenic Aedes aegypti (Dafa'alla et al. 2006). This marker gene was flanked by the ends of a piggyBac element potentially suitable for germline transformation. Newly born female mosquitoes were divided into groups of 50 mosquitoes each and injected in the thorax with plasmid injection mix (n = 200) or phosphate buffered saline for the control group (n = 50). After injection mosquitoes were fed on sugar and after three-five days screened for red fluorescence under a microscope. Mosquitoes that survived after the thorax injection (60-80%) were screened by fluorescence microscopy and fluorescence was observed in 2% of the injected mosquitoes (A in Figure).

 

A: fluorescence micrograph showing transient expression of DsRed2 molecular marker in a Culex quinquefasciatus mosquito injected with a DsRed2 plasmid (I) and a control group mosquito (C); B: ethidium bromide stained 1% agarose gel showing the amplification of the DsRed2 gene by polymerase chain reaction [M: DNA marker New England Biolabs (100 bp); N: no template control; I: gDNA from DsRed2 expressing individual; P: piggyBac Hr5IE1-DsRed2 plasmid (675 bp)]; C: reverse transcription-polymerase chain reaction of Cx. quinquefasciatus injected mosquito (I) utilising specific DsRed2 primers confirming the presence of cDNA M, marker as above.

 

To test that this fluorescence did correspond to DsRed2 and not autofluorescence, oligonucleotides were designed to amplify a 675 bp DsRed2 fragment (DsRed2-for: 5'ATGGCCTCCTCCGAGAACGT, DsRed2-rev: 5'CAGGAACAGGTGGTGGCGGC3'). The polymerase chain reaction (PCR) amplification showed a product of the expected size indicating the presence of DsRed2 sequences (B in Figure).

The only samples that were amplified in the PCR reaction were from mosquitoes with phenotypic expression; all other samples did not show any sign of plasmid in the PCR reaction (data not showed). To confirm that DsRed2 mRNA was being expressed, we performed reverse transcription-PCR using the same primers (C in Figure).

Several mosquito species have been successfully transformed and maintained as transgenic strains, such as: Ae. aegypti, Aedes albopictus, Aedes fluviatilis, Anopheles gambiae, Anopheles stephensi (Miller et al. 1987, Jasinskiene et al. 1998, Catteruccia et al. 2000, Rodrigues et al. 2006, Labbé et al. 2010). However, Culex mosquitoes are especially difficult to transform by the conventional method of injecting eggs and manipulating embryos because females lay their eggs in "rafts" so one is required to split the raft into individual eggs to perform microinjection and it is not possible to re-assemble them afterwards. This is not a problem for Aedes and Anopheles mosquitoes, which have been more easily genetically modified, as these mosquitoes lay their eggs individually, and in some cases Aedes eggs can resist desiccation for several months in a state of diapause, so it is possible for the egg to heal before embryogenesis starts. Culex mosquitos' embryogenesis cannot be delayed, so these two factors represent major limitations in Culex survival rate and transformation success.

The transient expression of DsRed2 in Cx. quinquefasciatus described here, demonstrates the mosquito's capability of expressing an effector gene driven by Hr5IE1 baculovirus promoter. The fact that RNA was transcribed from this plasmid, by the mosquito, demonstrates its capacity to express foreign effector genes and molecular markers. Piggybac transformation results in fairly random insertion of the transgene into the genome (with a recognition sequence of TTAA), so that expression can be heavily influenced by the surrounding DNA, resulting in a range of phenotypes (Nolan et al. 2002). Site-specific integration methods have recently been developed (Nimmo et al. 2006), but they still require an initial transposon based transformation. An innovative gene insertion method involving insertion of transgenes into the genome of adult mosquitoes via sterol carriers offers new prospects for transformation (Peng et al. 2011). This technique is especially interesting for mosquitoes such as Cx. quinquefasciatus, where other approaches have proved difficult. A transient expression system for rapid testing of candidate effector molecules would facilitate the development of genetic control strains in vector species, especially those where germline transformation is difficult.

 

ACKNOWLEDGEMENTS

To Meg Allen, for suggestion on Cx. quinquefasciatus embryo microinjections, and André Luís da Costa da Silva, for helping us during the adult microinjections.

 

REFERENCES

Allen ML, Christensen BM 2004. Flight muscle-specific expression of act88F: GFP in transgenic Culex quinquefasciatus Say (Diptera: Culicidae). Parasitol Int 53: 307-314.

Allen ML, O'Brochta DA, Atkinson PW, Levesque CS 2001. Stable, germ-line transformation of Culex quinquefasciatus (Diptera: Culicidae). J Med Entomol 38: 701-710.

Atkinson MP, Su Z, Alphey N, Alphey LS, Coleman PG, Wein LM 2007. Analyzing the control of mosquito-borne diseases by a dominant lethal genetic system. Proc Natl Acad Sci USA 104: 9540-9545.

Atkinson PW, Michel K 2002. What's buzzing? Mosquito genomics and transgenic mosquitoes. Genesis 32: 42-48.

Blandin S, Moita LF, Kocher T, Wilm M, Kafatos FC, Levashina EA 2002. Reverse genetics in the mosquito Anopheles gambiae: targeted disruption of the defensin gene. EMBO Rep 3: 852-856.

Catteruccia F, Nolan T, Loukeris TG, Blass C, Savakis C, Kafatos FC, Crisanti A 2000. Stable germline transformation of the malaria mosquito Anopheles stephensi. Nature 405: 959-962.

Cheng G, Liu L, Wang P, Zhang Y, Zhao YO, Colpitts TM, Feitosa F, Anderson JF, Fikrig E 2011. An in vivo transfection approach elucidates a role for Aedes aegypti thioester-containing proteins in flaviviral infection. PLoS ONE 6: e22786.

Coutinho-Abreu IV, Zhu KY, Ramalho-Ortigao M 2010. Transgenesis and paratransgenesis to control insect-borne diseases: current status and future challenges. Parasitol Int 59: 1-8.

Dafa'alla TH, Condon GC, Condon KC, Phillips CE, Morrison NI, Jin L, Epton MJ, Fu G, Alphey L 2006. Transposon-free insertions for insect genetic engineering. Nat Biotechnol 24: 820-821.

Danialou G, Comtois AS, Matecki S, Nalbantoglu J, Karpati G, Gilbert R, Geoffroy P, Gilligan S, Tanguay JF, Petrof BJ 2005. Optimization of regional intraarterial naked DNA-mediated transgene delivery to skeletal muscles in a large animal model. Mol Ther 11: 257-266.

Fang W, Vega-Rodríguez J, Ghosh AK, Jacobs-Lorena M, Kang A, St Leger RJ 2011. Development of transgenic fungi that kill human malaria parasites in mosquitoes. Science 331: 1074-1077.

Hansen IA, Attardo GM, Park JH, Peng Q, Raikhel AS 2004. Target of rapamycin-mediated amino acid signaling in mosquito anautogeny. Proc Natl Acad Sci USA 101: 10626-10631.

Jasinskiene N, Coates CJ, Benedict MQ, Cornel AJ, Rafferty CS, James AA, Collins FH 1998. Stable transformation of the yellow fever mosquito, Aedes aegypti, with the Hermes element from the housefly. Proc Natl Acad Sci USA 95: 3743-3747.

Kambris Z, Blagborough AM, Pinto SB, Blagrove MS, Godfray HC, Sinden RE, Sinkins SP 2010. Wolbachia stimulates immune gene expression and inhibits plasmodium development in Anopheles gambiae. PLoS Pathog 6: e1001143.

Labbé GM, Nimmo DD, Alphey L 2010. Piggybac and PhiC31 mediated genetic transformation of the Asian tiger mosquito, Aedes albopictus (Skuse). PLoS Negl Trop Dis 4: e788.

Miller LH, Sakai RK, Romans P, Gwadz RW, Kantoff P, Coon HG 1987. Stable integration and expression of a bacterial gene in the mosquito Anopheles gambiae. Science 237: 779-781.

Moreira LA, Edwards MJ, Adhami F, Jasinskiene N, James AA, Jacobs-Lorena M 2000. Robust gut-specific gene expression in transgenic Aedes aegypti mosquitoes. Proc Natl Acad Sci USA 97: 10895-10898.

Nimmo D, Alphey L, Meredith J, Eggleston P 2006. High efficiency site-specific genetic engineering of the mosquito genome. Insect Mol Biol 15: 129-136.

Nolan T, Bower TM, Brown AE, Crisanti A, Catteruccia F 2002. PiggyBac-mediated germline transformation of the malaria mosquito Anopheles stephensi using the red fluorescent protein dsRed as a selectable marker. J Biol Chem 277: 8759-8762.

Peng R, Maklokova VI, Chandrashekhar JH, Lan Q 2011. In vivo functional genomic studies of sterol carrier protein-2 gene in the yellow fever mosquito. PLoS ONE 6: e18030.

Rasgon JL 2011. Using infections to fight infections: paratransgenic fungi can block malaria transmission in mosquitoes. Future Microbiol 6: 851-853.

Ren X, Hoiczyk E, Rasgon JL 2008. Viral paratransgenesis in the malaria vector Anopheles gambiae. PLoS Pathog 4: e1000135.

Rodrigues FG, Oliveira SB, Rocha BC, Moreira LA 2006. Germline transformation of Aedes fluviatilis (Diptera: Culicidae) with the piggyBac transposable element. Mem Inst Oswaldo Cruz 101: 755-757.

Wilke ABB, Gomes AC, Natal D, Marrelli MT 2009a. Control of vector populations using genetically modified mosquitoes. Rev Saude Publica 43: 869-874.

Wilke ABB, Nimmo DD, St John O, Kojin BB, Capurro ML, Marrelli MT 2009b. Mini-review: genetic enhancements to the sterile insect technique to control mosquito populations. Asia Pac J Mol Biol Biotechnol 17: 65-74.

Zhang Y, Schlachetzki F, Li JY, Boado RJ, Pardridge WM 2003. Organ-specific gene expression in the rhesus monkey eye following intravenous non-viral gene transfer. Mol Vis 9: 465-472.

 

Received 1 August 2012
Accepted 7 December 2012
Financial support: FAPESP (2005/50225-2)
ABBW is fellowship of FAPESP (2008/57468-6).
+ Corresponding author: andrebw.br@gmail.com

Our Location

Memórias do Instituto Oswaldo Cruz

Av. Brasil 4365, Castelo Mourisco 
sala 201, Manguinhos, 21040-900 
Rio de Janeiro, RJ, Brazil

Tel.: +55-21-2562-1222

This email address is being protected from spambots. You need JavaScript enabled to view it.

Support Program

logo iocb

logo governo federal03h 
faperj   cnpq capes